2024 Phee401e vector

Phee401e vector

Author: ypng

August undefined, 2024

WebAug 16, 2024 · Building on the pHEE401E plasmid, a Cambia T-DNA adapted for 96 genome editing with CRISPR/Cas9 nucleases (Wang & al., 2015), we created a series of 97 vectors enabling selection and counter-selection of transgenics on the basis of seed 98 fluorescence. Toward this end, we replaced the hygromycin resistance marker of pHEE401E WebJul 21, 2015 · Arabidopsis mutants produced by constitutive overexpression of the CRISPR/Cas9 genome editing system are usually mosaics in the T1 generation. In this study, we used egg cell-specific promoters to drive the expression of Cas9 and obtained non-mosaic T1 mutants for multiple target genes with high efficiency. Comparisons of 12 …

ECT9 condensates with ECT1 and regulates plant immunity

WebJan 7, 2024 · pHEE401E article : bacterial resistance : Kanamycin cloning : growth notes : Please see the cloning protocol attachments for detailed descriptions on how to insert sgRNA sequences into this plasmid. growth strain : Egg cell-specific promoter-controlled expression of 3 FLAG-NLS-zCas9-NLS. WebGenetic transformation (GT) has emerged as a powerful tool for exploration of plant-RKN interactions and genetic improvement of RKN resistance. However, it is usually difficult to achieve a highly efficient and stable GT protocol for most crops due to the complexity of this process. Results marion michaelis finanzpräsidentin

The Tomato Transcription Factor SlNAC063 Is Required for …

WebpHEE401E . Cat# PEV-141 ... Description. A plant dual expression plasmid. Vector Type. Plant Dual Expression Vector, CRISPR . Expression Host. Plant Cell . Form. Powder; Solution Size. 2 μg; 10 μL . High Copy/Low Copy. High Copy ... WebNational Center for Biotechnology Information WebNov 22, 2024 · The vectors used were pHEE401E_UBQ_Bar and pBAtC_tRNA, which employ a one-promoter/one-sgRNA and a polycistronic-tRNA-gRNA strategy, respectively. Golden Gate cloning was performed with type IIS... dancing challenge

S401E - Littelfuse - Thyristor, 400 V, 10 mA - Newark

Addgene: pHSE401

WebApr 22, 2024 · After immunoprecipitation (IP) with anti-FLAG agarose, ubiquitinated BIK1 was detected by immunoblot (IB) using anti-HA antibodies (lanes 1 and 2) or treated with GST–USP2-cc (lane 3).... WebSep 24, 2024 · The structure of CSE-653 vector designed to sequentially cut S653 codon twice. pHEE401E backbone was used to ubiquitously express two sgRNAs by U6-26 and U6-29 promoters, and Cas9 was driven by an ... marion meresseWebMar 15, 2024 · Then the fragment was ligated into the binary vector pHEE401E by the restriction-ligation system ( Wang et al., 2015 ). Then, the recombinant plasmid pHEE401E-2sgRNA-SlNAC063 was transformed into wild-type tomato AC using the stable A. tumefaciens -mediated transformation method ( McCormick et al., 1986; Gupta and Van … marion metz

"WebApr 18, 2015 · /dnas_title="pHEE401E" ORIGIN : 1 gtttacccgc caatatatcc tgtcaaacac tgatagttta aactgaaggc gggaaacgac: 61 aatctgatcc aagctcaagc tgctctagca ttcgccattc aggctgcgca actgttggga: 121 agggcgatcg gtgcgggcct cttcgctatt acgccagctg gcgaaagggg gatgtgctgc: 181 aaggcgatta agttgggtaa cgccagggtt ttcccagtca cgacgttgta aaacgacggc " - Phee401e vector

Phee401e vector

crispr_cas9_arabidopsis/README.md at master - Github

WebJan 20, 2024 · Agrobacterium cells harboring the pHEE401E plasmid were grown in Luria–Bertani medium for 2 d and then resuspended with 10 mL liquid MS medium. Disks (1 × 1 cm) were cut from N. benthamiana leaves using a scalpel and soaked in the Agrobacterium solution for 5 min. Leaf disks were then removed and placed onto the MS0 … WebNov 22, 2024 · The pHEE401E_UBQ_Bar vector is a version in which the egg-specific promoter for Cas9 expression in the pHEE401E vector was replaced with the UBQ10 …

Did you know?

WebJun 22, 2024 · a A schematic representation of the gene drive that is inserted into the second exon of the CRYPTOCHROME 1 ( CRY1) gene on Chromosome IV using CRISPR/Cas9-mediated homology-directed repair (HDR).... WebSep 27, 2024 · The target-specified guide RNA (gRNA) sequences were cloned into a binary vector harbouring the cas9 gene under control of a ubiquitin promoter from parsley (Figure S1; Kawalleck et al ., 1993 ). The binary vectors targeting CsGTR1 and CsGTR2 harboured four gRNAs, while the vector for CsMYB28 and CsMYB29 contained three gRNAs.

WebThe construct is split into one module vector set (pCBC-DT1T2) containing two single guide RNAs (sgRNAs) and a binary vector based on pCAMBIA (pHEE401E) containing additional … WebJan 17, 2024 · pHEE401E binary vector. pHEE401E is based on pCambia backbone for Agrobacterium-mediated transformation. It contains the complementary parts of the …

WebNov 22, 2024 · The pHEE401E vector has a type IIS restriction-enzyme-recognition site for ligation [6]. The other is a pBAtC-tRNA vector that uses a polycistronic tRNA-gRNA expression system and has two AarI type IIS restriction enzyme sites. Originally, these two vectors could carry two sgRNAs. WebDec 19, 2024 · To construct pHEE401E (Wang et al., 2015) vectors targeting four different sites of PAR1 and one site of JAZ1 or GAI, the dsDNA was fused to the BsaI-digested …

WebMar 15, 2024 · Then the fragment was ligated into the binary vector pHEE401E by the restriction-ligation system (Wang et al., 2015). Then, the recombinant plasmid pHEE401E …

WebApr 13, 2024 · To generate mutants of npf8.4-2 and npf8.4-3, two single guide RNAs (AGTTCCGGGTCTTAAGCCAG and GAGATGCAAACACTAACCCG; Genomics Inc.) targeting NPF8.4 were inserted into the binary vector pHEE401E ... marion merelleWebSep 20, 2024 · Overexpression of SNIPER1 leads to globally reduced accumulation of sNLRs, but not the downstream helper NLRs ADR1 and NRG1, resulting in compromised … dancing cars videoWebThe vector pHEE401E was used as an acceptor vector. The CRISPR-associated endonuclease zCas9 was from the Zea mays, driven by Arabidopsis EC1.1 (AT1G76750) promoter (Xing et al., 2014). Homozygous transgenic plants were identified using PCR-based and sequenced genotyping. All primers used for genotyping are listed in Supplemental … dancing challenge matWebpHEE401E vector Sequence Copy Sequence Download GeneBank File(.gb) LOCUS Exported 17112 bp ds-DNA circular SYN 13-MAY-2024 DEFINITION Egg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target ACCESSION . VERSION . dancing centers sacramentoWebPrinciple and design of JMJ epigenome editing constructs targeting APX2. Schematic representation of generated constructs for validation of sgRNA design by transient transactivation in N. benthamiana (A) and for generation of stable lines (B) in the pHEE401E vector backbone. Both types of constructs contain an sgRNA cassette, which is … dancing cerealWebModified from the pHEE401E T-DNA vector described by Wang &al. (2015) Genome Biol 16: 144, doi:10.1186/s13059-015-0715-0: the Hygromycin selection maker of the T-DNA was exchanged with a cassette enabling selection on the basis of CFP-fluorescence in seeds; the egg-cell specific promoter of Cas9 was exchanged with a ubiquitin promoter. marion metriconWebOct 24, 2024 · Two sgRNAs were designed and cloned into pHEE401E as described by Wang et al. (2015b). ... China) for the CRISPR/Cas9 vector; Xiao-Su Gao, Jiqin Li, Yun-Xiao He, and Shui-Ning Yang (Chinese Academy of Sciences Center for Excellence in Molecular Plant Sciences, China) for skillful technical assistance; Hongtao Liu, Lin Xu (Chinese Academy … dancing cheese video